Full-Text Search:
Home|Journal Papers|About CNKI|User Service|FAQ|Contact Us|中文
《Journal of Jilin Agricultural University》 2003-01
Add to Favorite Get Latest Update

Cloning and Sequence Mutation Analysis of Quinolone Resistance Determining Regions of Pathogenic Aeromonas hydrophil

LU Qiang1, ZHENG Wei1, LI Lianrui2, LIU Mingyuan1, YU Haibin3(1.Faculty of Animal Science and Veterinary Medicine, The Quartermaster University of PLA, Changchun,Jilin 130062,China; 2.Institute of Animal Science and Technology, Tarim University of Agriculture Reclamation, Alar,Xinjiang 843300; 3.Animal Checking Department of Jiutai,Jiutai,Jilin 130500,China)  
In order to invesgate the mechanism of quinolones drug resistance of Aeromonas hydrophil, the genome of four drug resistant strains, two susceptible strains isolated in Jilin Province were amplified by PCR. The primers, used included A1:AGAGTTCCTATCTTGATTACG;A2:CTGTGATGTAGGTCATCAACT, which were synthesized according to the gyr A gene sequence of A. salmonicida, which amplify the quinolones resistancedetermining region(QRDR) of the gyrA gene. PCR products were cloned into vector pMD18T, the recombinant vectors were transfered into the E.coli DH5αcompetent cells. After identification, the sequences of the amplified QRDRs were determined and analysised by DNA star software. Four mutation sites of amino acid sequence were found, which were serine 83toisoleucine, leucine 92tomethionine, isoleucine 174tophenylalanine and an adjacent site asparagines 202, leucine 203toasparatic acid, arginine. Among 4 mutation sites, only the mutation of site 83 was identical with E.coli and other drug resistant bacteria, the molecular weigh of the mutated amino acid residue was bigger than original residue. The QRDR sequences of four drug resistant strains and two susceptible strains were registered to Genebank with accession numbers being AY039655, AY039656, AY138539,AY138540,AY138537,AY138538.
【Fund】: 国家自然科学基金资助项目(30070587);; 吉林省自然科学基金资助项目(20020648)
【CateGory Index】: S917.1
Download(CAJ format) Download(PDF format)
CAJViewer7.0 supports all the CNKI file formats; AdobeReader only supports the PDF format.
【References】
Chinese Journal Full-text Database 1 Hits
1 XIAO Dan,CAO Haipeng,HU Kun,YANG Xianle College of Fisheries and Life Science,Shanghai Ocean University,State Collection Centre of Aquatic Pathogen,Shanghai 201306,China;ERIC-PCR genotyping and drug resistant analysis of pathogenic Aeromonas hydrophila from freshwater animals[J];Journal of Fishery Sciences of China;2011-05
【Citations】
Chinese Journal Full-text Database 1 Hits
1 Lu Chengping Department of Veterinary Medicine, Nanjing Agricultural University, 210014;PATHOGENIC AEROMONAS HYDROPHILA AND THE FISH DISEASES CAUSED BY IT[J];Journal of Fisheries of China;1992-03
【Co-citations】
Chinese Journal Full-text Database 10 Hits
1 HU Xiu-cai (College of Life Science, Xuzhou Normal University, Xuzhou, Jiangsu 221116);Study on the Characteristics of Aeromonas sobria Producing Pigment and Its Outer Membrane Proteins (OMPs) Pattern[J];Journal of Anhui Agricultural Sciences;2008-08
2 ZHANG Yu-fen et al(Department of Biological Science,North China Coal Medical College,Tangshan,Hebei 063000);Drug Sensitivity Test of Pathogen of Bacterial Septicemia of Carps[J];Journal of Anhui Agricultural Sciences;2008-30
3 GAO Jian-zhong (College of Fisheries and Life Science,Shanghai Ocean University,Shanghai 200090);Comparison on Detecting Aeromonas hydrophila by Real-time Fluorescence PCR with Conventional PCR and Bacterium Culture[J];Journal of Anhui Agricultural Sciences;2008-31
4 ZHANG Yu-fen et al (Department of Life Sciences,North China Coal Medical College,Tangshan,Hebei 063000);Isolation and Identification of Aeromonas hydrophila from Carp[J];Journal of Anhui Agricultural Sciences;2008-31
5 GAO Jian-zhong et al(College of Fisheries and Life Science,Shanghai Ocean University,Shanghai 201306);Application of Real-time PCR for Detection of Aeromonas hydrophila by Using MGB Fluorescence Probe[J];Journal of Anhui Agricultural Sciences;2009-19
6 ZHANG Yu-fen et al(Department of Life Science,North China Coal Medical College,Tangshan,Hebei 063000);Research Progress on Aeromonas hydrophila[J];Journal of Anhui Agricultural Sciences;2009-26
7 ZU Guo zhang 1,YU Wei yi 1,LI Jin nian 1,YANG Qi chao 1,ZHOU Guang jun 2,LI Jia yun 3 (1.Department of Fisheries,Anhui Agricultural University,Hefei 230036; 2.Goose Breeding Farm of Liuan City;3.Aquatic Seed Multiplication Farm of Liuan City;Studies on Serveral Bacteriosis and the Pathogeny of Grass Carp[J];JOURNAL OF ANHUI AGRICULTURAL UNIVERSITY;2001-03
8 SUN Hong xiang,TAO Yong jun (College of Animal Science,Zhejiang University,Hangzhou 310029,China);Pharmacodynamic Study on Biebaoning against Disease in Soft shelled Turtle (Trionyx sinensis)[J];Fisheries Science;2001-04
9 ZHANG Xiao jun,CHEN Cui zhen,FANG Hai,HE Zhen ping,GONG Yuan fang (Department of Animal Science,Hebei Vocational Teachers College,Changli 066600,China);Immunity Effects Observation on Fish Inoculated by Antigen of Aeromona[J];Fisheries Science;2002-01
10 MEI Guang hai,ZHU Yong sheng,CAO Rong,TANG Zhi yong (Fisheries Technical Extension Station of Haian County,Haian 226600,China);A Preliminary Study on the Bacterial Pseudotuberculosis of Wintering Tilapia[J];Fisheries Science;2002-04
【Co-references】
Chinese Journal Full-text Database 10 Hits
1 QIN Guo-min et al (Key Laboratory of Oceanic Biotechnology of Jiangsu Province,Huaihai College of Technology,Lianyungang,Jiangsu 222005);Infection of Aeromonas veronii from Diseased Cyprinus carpio L.and the Biological Characteristics of Its Pathogen[J];Journal of Anhui Agricultural Sciences;2008-19
2 LIN Ju-chun et al(College of Animal Medical,Sichuan Agricultural University,Ya′an,Sichuan 625014);Investigation on Drug Resistance of Clinical Isolates from Aeromonas hydrophila on Antibiotics[J];Journal of Anhui Agricultural Sciences;2009-15
3 Shao Jianzhong Xiang Lixin Mao Shujian Shen Zhilong(Biological Institute of Hangzhou University, Hangzhou, 310028);FINE STRUTURE, GENOME AND POLYPEPTIDES OF THE MUSSEL HYRIOPSIS CUMINGII PLAGUE VIRUS[J];Chinese Journal of Virology;1993-02
4 XIAO Tiao-Yi① LIU Qiao-Lin① ZHANG Huai-Yun ①② ZHONG Lei① GE Xi-Kai① XU Bao-Hong① SU Jian-Ming①(① College of Animal Science and Technology,Hunan Agricultural University,Changsha 410128;② Central South University of Forestry and Technology,Changsha 410081,China);Effects of Hyriopsis cumingii Plague Virus on Digestive Organs of the H. cumingii[J];Chinese Journal of Zoology;2009-03
5 Li Hunarong Tian Liying Cui Defeng Zhang Er 1 (Beijing Agricultural College,Beijing 102206);Sensitivity Test of Pathogenic Aeromonas hydrophila to 31 Kinds of Antibiotics[J];Journal of Beijing Agricultural College;2001-03
6 YANG Pin-hong 1,2 LI meng-jun 2 WU Wei-xing 2, XIE Chun-hua 2,WANG Xiao-yan 2 (1 Department of Life science,Hunan University of Arts and Science.Hunan Changde,415000) (2 Hunan Dongting Aquiculture Co.,Ltd.Hunan Changde,415000);INDUSTRY OF FRESHWATER PEARL PROBLEM,DEVELOPMENT THAT FACE TREND AND COUNTERMEASURE IN CHINA[J];;2003-04
7 DONG Chuan fu 1,2 ,LIN Tian long 2,CHEN Ri sheng 2,CHEN Qiang 2 (1 Fishery College,Huazhong Agricutural University,Wuhan 430070,China;2 Anamal Husbandry and Veterinary Medicine Institute,Fujian Acedemy of Agricultural Sciences,Fuzhou 350003;Studies on Pathogencitices and Biochemical Characteristics of Pathogens which Caused Anguilla japonica Bacterial Septicaemia and Ascites[J];Fisheries Science;2002-01
8 LIN Qi-cun,CAI Li-juan,YANG Zhong-jing,YU Xia-kui,FENG Xiao-yu(Hangzhou Institute of Agricultural Science,Hangzhou 310024,China);Isolation,Identification and Artificial Infection Test of Pathogen from Ulcerous Tinca tinca[J];Fisheries Science;2005-11
9 ZHANG Xin-zhong,ZHANG Shi-xiu,LI Hai-ping,FU You-li,ZHOU Yong-can,XIE Zhenyu(Ocean College,Hainan University,Haikou 570228,China);The Application of Multiple PCR in Rapid Identification of Bacterium Vibro vulnificus[J];Fisheries Science;2007-12
10 HUANG Chun-ji,Zhang Ke-bin, GUANG Li-xia,et al. (Xinqiao Hospital,the Third Military Medical University,Chongqing 400037,China);Amplification and cloning of elastase coding sequence from pseudomonas aeruginosa[J];Chongqing Medical Journal;2005-06
China Proceedings of conference Full-text Database 1 Hits
1 Cui Lai-Bin1,2 Ye Xing1 1.Pearl River Fisheries Research Institute,Chinese Academy of Fishery Sciences;Key Laboratory of Tropical & Subtropical Fish Breeding & Cultivation,Guangzhou 510380; 2.College of Aqua-life Science and Technology,Shanghai Ocean University,Shanghai 201306,China;Identification of a pathogen Pseudomonas aeruginosa from grass carp[A];[C];2009
【Secondary Citations】
Chinese Journal Full-text Database 10 Hits
1 Sun Qihuan;Sun Peifang;Jin Lihua;Wu Jiannong Shanghai Fisheries University;ON THE PATHOGENIC BACTERIA OF THE HEMOLYTIC ASCITESOSIS OF ALLOGYNOGENETIC CRUCIAN CARP[J];Journal of Fisheries of China;1991-02
2 Yang Zheng-shi National Institute for the Control of Pharmaceutical & Biological Products,Beijing 100050;A Study on Pathogens during an Outbreak of Fish Disease,the Recovery of a New Species of Aeromonas as the Causative Agent[J];Chinese Journal of Microecology;1990-01
3 Lin Jianmei Fan Xinjian FenPing,et al. Department of Infectioas Diseases,West China University of Medical Sciences,Chengdu 610041;THE EXPERIMENTAL STUDY OF FLUOROQUINOLONES RESISTANT STRAINS IN GRAM NEGATIVE BACILLI[J];CHINESE JOURNAL OF MICROECOLOGY;1998-01
4 Zhang Junmin, Wu Jian, Zhao Liping, et al. Department of Microbiology, the General Hospital of PLA, Beijing 100853;A gyrA gene mutation in clinical Escherichia coli[J];Chinese Journal of Laboratory Medicine;1998-03
5 Ding Jianqiang,Ma Yilin,Gong Zheng,et al.(Department of Infectious Diseases,the First Affiliated Hospital,Zhejiang Medical University);Detection of Point Mutations in the gyr A Gene of Highly Fluoroquinolone Resistant Escherichia Coli by PCR[J];;1999-01
6 Li Guoming, Chen Qun and Wang Shengchun(Department of Microbiology, Guangdong Medical College, Zhanjiang 524023);Study on the resistance of Neisseria gonorrhoeae to fluoroquinolone[J];CHINESE JOURNAL OF ANTIBIOTICS;2000-02
7 Xiao Yong hong, Wang Qi nan and Peng Ming li * (The First Affiliated Hospital, Chongqing University of Medical Sciences, Chongqing 400016; The Central Laboratories, Chongqing University of Medical Sciences, Chongqing 400016);Quinolone resistant mechanisms in Salmonella typhi[J];Chinese Journal of Antibiotics;2000-06
8 Li Shi jie *, Zhang Jun min ** and Cui Yan ** (* Puyang People′s Hospital, Puyang 457000; ** General Hospital of PLA, Beijing 100853);Tendency analysis of resistance of ciprofloxacin to common pathogenic bacteria in clinics[J];Chinese Journal of Antibiotics;2001-01
9 Chen Huaiqing;Study on Pathogen of Bacterial Hemorrhagic Septicemia of Rice Eel (Monopterus albus)[J];Chinese Journal of Zoonoses;1991-04
10 Zheng Guoxing Zhou Kai (East China Sea Fisheries Research Institute,Chinese Academy of Fishery Sciences,Shanghai 200090);Drug resistance of Aeromonas hydrophila strains isolated from skin ulcer of Anguilla anguilla[J];Journal of Fishery Sciences of China;1999-03
©2006 Tsinghua Tongfang Knowledge Network Technology Co., Ltd.(Beijing)(TTKN) All rights reserved